Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4649-3p URS00001C0099_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4649: Hsa-mir-4649 is a microRNA that has been identified as a potential biomarker for non-ischemic heart failure. Integrative bioinformatics analysis has shown that hsa-mir-4649, along with hsa-miR-1297, can target COX-2 and may be used as biomarkers for non-ischemic heart failure [PMC7419645]. Further investigation revealed a positive correlation between plasma COX-2 and plasma hsa-mir-4649 [PMC7419645]. Binary logistical regression analysis was used to evaluate the predictive powers of plasma PTGS2 (COX-2), hsa-mir-4649, and hsa-miR-1297 for heart failure [PMC7419645]. Hsa-mir-4649 was found to be significantly increased in the plasma of patients with non-ischemic heart failure compared to control subjects [PMC7419645]. Additionally, the expression of hsa-mir-4649 was associated with a worse outcome in patients with B-cell acute lymphoblastic leukemia (B-ALL) [PMC9624360]. Interestingly, hsa-mir-4649 polymorphisms were found to reside within the Drosha cleavage site and within the exon 1 of the AEBP1 host gene [PMC4299713]. Overall, these findings suggest that hsa-mir-4649 may play a role in non-ischemic heart failure and B-cell acute lymphoblastic leukemia.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUGAGGCCUGCCUCUCCCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications