Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-218a URS00001BF5DD_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 5 databases (MirGeneDB, miRBase, PSICQUIC, ENA, RefSeq). Danio rerio (zebrafish) dre-miR-218a sequence is a product of miR-218, dre-miR-218a, mir218a-2, mir218a-1, miR-218a genes. Found in the zebrafish reference genome.

Interactions 6

According to PSICQUIC, Danio rerio (zebrafish) dre-miR-218a interacts with:

Interaction id Participant Synonyms
URS00001BF5DD_7955-0 B0S6J3 B0S6J3
URS00001BF5DD_7955-3 B0S6J3 B0S6J3
URS00001BF5DD_7955-1 F1QBD4 F1QBD4
URS00001BF5DD_7955-4 F1QBD4 F1QBD4
URS00001BF5DD_7955-2 F1R2D2 F1R2D2
URS00001BF5DD_7955-5 F1R2D2 F1R2D2

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUGUGCUUGAUCUAACCAUGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 38 other species

    1. Anolis carolinensis (green anole) aca-miR-218-5p
    2. Bos taurus bta-miR-218
    3. Callorhinchus milii Cmi-Mir-218-P4_5p (mature (guide))
    4. Canis lupus familiaris Cfa-Mir-218-P1_5p (mature (guide))
    5. Cavia porcellus cpo-miR-218-5p
    6. Chiloscyllium plagiosum microRNA cpl-miR-218-5p
    7. Chrysemys picta (Painted turtle) cpi-miR-218-5p
    8. Cricetulus griseus cgr-miR-218a
    9. Cyprinus carpio (common carp) ccr-miR-218a
    10. Dasypus novemcinctus dno-miR-218-5p
    11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-218-P1_5p (mature (guide))
    12. Eptatretus burgeri (inshore hagfish) Ebu-Mir-218-P5_5p (mature (guide))
    13. Gadus morhua gmo-miR-218a-5p
    14. Gekko japonicus Gja-Mir-218-P2_5p (mature (guide))
    15. Haplochromis burtoni abu-miR-218a
    16. Homo sapiens Hsa-Mir-218-P1_5p (mature (guide))
    17. Latimeria chalumnae Lch-Mir-218-P4_5p (mature (guide))
    18. Lepisosteus oculatus Loc-Mir-218-P4_5p (mature (guide))
    19. Macaca mulatta Mml-Mir-218-P1_5p (mature (guide))
    20. Maylandia zebra (zebra mbuna) mze-miR-218a
    21. Microcebus murinus (gray mouse lemur) mmr-miR-218b
    22. Monodelphis domestica Mdo-Mir-218-P1_5p (mature (guide))
    23. Monopterus albus (swamp eel) Mal-Mir-218-P4_5p (mature (guide))
    24. Mus musculus Mus_musculus piRNA piR-mmu-6508795
    25. Neolamprologus brichardi nbr-miR-218a
    26. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-218
    27. Ophiophagus hannah (king cobra) oha-miR-218-5p
    28. Oreochromis niloticus oni-miR-218a
    29. Ornithorhynchus anatinus Oan-Mir-218-P4_5p (mature (co-guide))
    30. Oryctolagus cuniculus ocu-miR-218-5p
    31. Otolemur garnettii oga-miR-218a
    32. Petromyzon marinus (sea lamprey) pma-miR-218a-5p
    33. Pundamilia nyererei pny-miR-218a
    34. Python bivittatus (Burmese python) Pbv-Mir-218-P2_5p (mature (guide))
    35. Rattus norvegicus Rno-Mir-218-P1_5p (mature (guide))
    36. Salmo salar ssa-miR-218-5p
    37. Sarcophilus harrisii Sha-Mir-218-P1_5p (mature (guide))
    38. Scyliorhinus torazame Sto-Mir-218-P4_5p (mature (guide))
    39. Sus scrofa (pig) ssc-miR-218b
    40. Takifugu rubripes fru-miR-218a
    41. Tetraodon nigroviridis tni-miR-218a
    42. Tor tambroides miR-218a
    43. Xenopus laevis (African clawed frog) Xla-Mir-218-P4b_5p (mature (guide))
    44. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-218-P4_5p (mature (guide))
    Publications New