v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Escherichia sp. TC-EC600-tetX4 tRNA-Met secondary structure diagram

Escherichia sp. TC-EC600-tetX4 tRNA-Met URS00001BBAFC_2857061

Automated summary: This tRNA sequence is 77 nucleotides long and is found in Escherichia sp. TC-EC600-tetX4. Annotated by 1 database (ENA). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    CGCGGGGUGGAGCAGCCUGGUAGCUCGUCGGGCUCAUAACCCGAAGAUCGUCGGUUCAAAUCCGGCCCCCGCAACCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 41 other species

    1. Acinetobacter pittii tRNA-Met
    2. Escherichia coli 3-373-03_S4_C1 tRNA-Met
    3. Escherichia coli 3-373-03_S4_C2 tRNA-Met
    4. Escherichia coli 3-373-03_S4_C3 tRNA-Met
    5. Escherichia coli BW25113 tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
    6. Escherichia coli BW2952 tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
    7. Escherichia coli DH1 tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
    8. Escherichia coli ER2796 tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
    9. Escherichia coli HT115 tRNA-Met
    10. Escherichia coli J53 tRNA-Met
    11. Escherichia coli K-12 tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
    12. Escherichia coli KLY tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
    13. Escherichia coli NCTC 50110 tRNA-Met
    14. Escherichia coli O16:H48 tRNA-Met
    15. Escherichia coli S17 tRNA-Met
    16. Escherichia coli str. K-12 substr. DH10B tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
    17. Escherichia coli str. K-12 substr. MC4100 tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
    18. Escherichia coli str. K-12 substr. MDS42 tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
    19. Escherichia coli str. K-12 substr. MG1655 tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
    20. Escherichia coli str. K-12 substr. W3110 tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
    21. Escherichia coli tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
    22. Escherichia coli XH001 tRNA-Met
    23. Escherichia sp. Gen1 tRNA-Met
    24. Escherichia sp. TM-G17TGC tRNA-Met
    25. Acinetobacter baumannii ATCC 19606 = CIP 70.34 = JCM 6841 E-site tRNA from Acinetobacter baumannii ATCC 19606 = CIP 70.34 = JCM 6841 (PDB 6YTF, chain 7)
    26. synthetic construct FORMYL-METHIONYL-TRNAFMET2 from synthetic construct (PDB 2FMT, chain D)
    27. Klebsiella pneumoniae tRNA-Met(cat)
    28. Thermus thermophilus HB27 P-site tRNAfMET from Thermus thermophilus HB27 (PDB 4V4J, chain z)
    29. Thermus thermophilus P-tRNA from Thermus thermophilus (PDB 3J9Z, chain S6)
    30. Salmonella enterica subsp. enterica serovar Anatum tRNA-Met
    31. Salmonella enterica subsp. enterica serovar Copenhagen tRNA-Met
    32. Salmonella enterica subsp. enterica serovar Newport tRNA-Met
    33. Salmonella enterica subsp. enterica serovar Typhimurium (Salmonella typhimurium) tRNA-Met
    34. Salmonella enterica subsp. enterica tRNA-Met
    35. Salmonella enterica tRNA-Met
    36. Salmonella sp. HNK130 tRNA-Met
    37. Shigella flexneri tRNA-Met
    38. Shigella sp. tRNA-Met
    39. synthetic Escherichia coli C321.deltaA tRNA-fMet (CAT) (tRNA-fMet-CAT-2-1)
    40. uncultured bacterium tRNA-Met
    41. Xanthomonas citri pv. citri tRNA-Met
     2D structure