Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-15a URS00001BACF3_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-15a: Ssc-mir-15a is a microRNA that has been identified in M pig, specifically in the 60/120, 120/150, 150/180, and 180/210 dpn comparisons [PMC4890935]. It is one of the nine common miRNAs found in these comparisons [PMC4890935]. Ssc-mir-15a has been found to potentially regulate genes in the neutrophil degranulation pathway and the TLR cascade pathway [PMC8851844]. It is also inhibited by SFN in porcine miRNAs [PMC9179638]. TargetScan predicts that ssc-mir-15a targets SMAD7 [PMC9179638]. Ssc-mir-15a is one of several miRNAs that are significantly regulated at 14 days post-infection, suggesting its involvement in the clearance of infection [PMC4759598]. It has also been implicated in the modulation of apoptosis and viral recognition signaling cascades along with ssc-miR-18a, ssc-miR-21, ssc-miR-29b, and hsa-miR-590-3p [PMC5909910]. These miRNAs are significantly up-regulated on day 3 after challenge but not regulated at other time points [PMC5909910]. Ssc-mir-15a has a specific forward primer for amplification during miRNA analysis [PMC4908419]. Additionally, circ_0000576 has been predicted to act as a sponge for ssc-mir-15a along with ssc-miR-98 and ssc-miR-885-3p to regulate muscle growth and development [PMC10099641].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCACAUAAUGGUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Bos taurus bta-miR-15a
  2. Canis lupus familiaris cfa-miR-15a
  3. Chiloscyllium plagiosum microRNA cpl-miR-15a
  4. Gallus gallus gga-miR-15a
  5. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72434
  6. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-15a
  7. Ornithorhynchus anatinus (platypus) oan-miR-15a-5p
  8. Otolemur garnettii oga-miR-15a
  9. Pteropus alecto (black flying fox) pal-miR-15a-5p
  10. Taeniopygia guttata tgu-miR-15a-5p
  11. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-1551775
Publications