Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72434 URS00001BACF3_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCACAUAAUGGUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Bos taurus bta-miR-15a
  2. Canis lupus familiaris cfa-miR-15a
  3. Chiloscyllium plagiosum microRNA cpl-miR-15a
  4. Gallus gallus gga-miR-15a
  5. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-15a
  6. Ornithorhynchus anatinus (platypus) oan-miR-15a-5p
  7. Otolemur garnettii oga-miR-15a
  8. Pteropus alecto (black flying fox) pal-miR-15a-5p
  9. Sus scrofa (pig) ssc-miR-15a
  10. Taeniopygia guttata tgu-miR-15a-5p
  11. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-1551775