Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-376c-5p URS00001B9F58_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-376c: Hsa-mir-376c is a microRNA that has been found to be up-regulated in tumors of long-survivors [PMC2804711]. In a study by Song et al, 16 microRNAs were identified as being overexpressed in the sera of patients with gastric cancer (GC), but further investigation suggested that only hsa-miR-221, hsa-miR-744, and hsa-mir-376c were potential biomarkers [PMC5431292]. The study by Song et al focused on the identification of microRNAs as potential biomarkers for GC [PMC5431292]. Hsa-mir-376c was found to be overexpressed in the sera of GC patients and was suggested as a potential biomarker for this disease [PMC5431292]. Additionally, ALK tyrosine kinase receptor precursor mRNA was identified as a putative target of hsa-mir-376c [PMC2804711]. The up-regulation of ALK tyrosine kinase receptor precursor mRNA in tumors of long-survivors suggests that it may play a role in tumor progression and survival [PMC2804711]. These findings highlight the potential importance of hsa-mir-376c and its target ALK tyrosine kinase receptor precursor mRNA in GC and tumor progression. Further research is needed to fully understand their roles and potential clinical applications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUGGAUAUUCCUUCUAUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications