Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila sechellia dse-miR-277 URS00001B9842_7238

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Drosophila sechellia. Annotated by 2 databases (Ensembl Metazoa, miRBase). Described in 1 paper. Drosophila sechellia dse-miR-277 sequence is a product of FBtr0295227_df_nrg gene. Found in the Drosophila sechellia reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAAAUGCACUAUCUGGUACGACA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 145 other species

    1. Acyrthosiphon pisum (pea aphid) api-miR-277
    2. Aedes aegypti (yellow fever mosquito) Aae-Mir-277_3p (mature (guide))
    3. Anopheles gambiae (African malaria mosquito) aga-miR-277
    4. Apis mellifera ame-miR-277-3p
    5. Blattella germanica (German cockroach) Bge-Mir-277_3p (mature (guide))
    6. Bombyx mori bmo-miR-277-3p
    7. Dinoponera quadriceps dqu-miR-277-3p
    8. Drosophila ananassae dan-miR-277
    9. Drosophila erecta der-miR-277
    10. Drosophila grimshawi dgr-miR-277
    11. Drosophila melanogaster dme-miR-277-3p
    12. Drosophila mojavensis dmo-miR-277
    13. Drosophila persimilis dpe-miR-277
    14. Drosophila pseudoobscura dps-miR-277
    15. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294385_df_nrg
    16. Drosophila simulans Dsi-Mir-277_3p (mature (guide))
    17. Drosophila virilis dvi-miR-277-3p
    18. Drosophila willistoni dwi-miR-277
    19. Drosophila yakuba dya-miR-277
    20. Eurosta solidaginis miR-277
    21. Heliconius melpomene (postman butterfly) Hme-Mir-277_3p (mature (guide))
    22. Manduca sexta (tobacco hornworm) mse-miR-277
    23. Nasonia giraulti ngi-miR-277
    24. Nasonia longicornis nlo-miR-277
    25. Nasonia vitripennis nvi-miR-277
    26. Plutella xylostella pxy-miR-277
    27. Polistes canadensis pca-miR-277-3p
    28. Spodoptera frugiperda sfr-miR-277-3p
    29. Tribolium castaneum (red flour beetle) tca-miR-277-3p