Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Blattella germanica (German cockroach) Bge-Mir-277_3p (mature (guide)) URS00001B9842_6973

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Blattella germanica. Annotated by 1 database (MirGeneDB). Described in 1 paper.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAAAUGCACUAUCUGGUACGACA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 30 other species

    1. Acyrthosiphon pisum (pea aphid) api-miR-277
    2. Aedes aegypti Aae-Mir-277_3p (mature (guide))
    3. Anopheles gambiae (African malaria mosquito) aga-miR-277
    4. Apis mellifera ame-miR-277-3p
    5. Bombyx mori (domestic silkworm) bmo-miR-277-3p
    6. Dasypus novemcinctus Dan-Mir-277_3p (mature (guide))
    7. Dinoponera quadriceps dqu-miR-277-3p
    8. Drosophila ananassae dan-miR-277
    9. Drosophila erecta der-miR-277
    10. Drosophila grimshawi dgr-miR-277
    11. Drosophila melanogaster dme-miR-277-3p
    12. Drosophila mojavensis dmo-miR-277
    13. Drosophila persimilis dpe-miR-277
    14. Drosophila pseudoobscura dps-miR-277
    15. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294385_df_nrg
    16. Drosophila sechellia dse-miR-277
    17. Drosophila simulans miRNA FBtr0296149_df_nrg
    18. Drosophila virilis dvi-miR-277-3p
    19. Drosophila willistoni dwi-miR-277
    20. Drosophila yakuba dya-miR-277
    21. Eurosta solidaginis (goldenrod gall fly) miR-277
    22. Heliconius melpomene Hme-Mir-277_3p (mature (guide))
    23. Manduca sexta mse-miR-277
    24. Nasonia giraulti ngi-miR-277
    25. Nasonia longicornis nlo-miR-277
    26. Nasonia vitripennis nvi-miR-277
    27. Plutella xylostella pxy-miR-277
    28. Polistes canadensis pca-miR-277-3p
    29. Spodoptera frugiperda (fall armyworm) sfr-miR-277-3p
    30. Tribolium castaneum tca-miR-277-3p