Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-106a-5p URS00001B64CE_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-106a: The mmu-mir-106a cluster is a type of miRNA cluster that has been studied in various mouse tumors [PMC1794537]. In these tumors, approximately 70% showed increased expression levels of mmu-mir-106a [PMC1794537]. Synthetic RNA oligos were used to generate a calibration curve for mmu-mir-106a [PMC1794537]. Retroviral integrations were found upstream of the mmu-mir-106a cluster in some tumors, and these integrations were associated with increased expression levels of the mature miRNA [PMC1794537]. The retroviral integrations in this region affected the expression of the mir-106a cistron, as measured by qPCR [PMC1794537]. The mir-106a cistron is part of the primary transcripts containing the miRNA cluster [PMC1794537]. In addition to mmu-mir-106a, other miRNAs such as mmu-miR-20b and mmu-miR-19b-2 have been found to be upregulated in tumors with retroviral integration within the mir-106a-363 locus [PMC7290785]. The expression levels of mmu-mir-106a have been shown to be decreased in mice with diabetic peripheral neuropathy and it has been identified as a target for 12/15-lipoxygenase (12/15 LOX) [PMC8914318]. Overall, studies have demonstrated that retroviral insertions can induce overexpression of oncogenic miRNAs such as mmu-mir17 and mmu-mir 363, among others [PMC2257975].

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAAGUGCUAACAGUGCAGGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications