Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ARHGAP31 antisense RNA 1 (ARHGAP31-AS1) URS00001B54E5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ARHGAP31-AS1: ARHGAP31-AS1 is a long non-coding RNA (lncRNA) that has been identified as one of the immune-related prognostic lncRNAs in various studies [PMC7441444]. In a study using TCGA and CGGA as the training cohort, ARHGAP31-AS1 was found to be one of the 15 immune-related prognostic lncRNAs identified by univariate Cox regression [PMC7441444]. Another study focused on cuproptosis-related genes and identified ARHGAP31-AS1 as one of the 6 prognostic lncRNAs associated with these genes [PMC9747936]. The study also showed that ARHGAP31-AS1 had lower levels in individuals with high risk compared to low risk [PMC9747936]. Furthermore, univariate Cox regression analysis revealed that ARHGAP31-AS1 was a protective factor for overall survival (OS) [PMC9747936]. The risk score calculation for individuals included ARHGAP31-AS1 as one of the factors [PMC9747936]. In another study, ARHGAP31-AS1 was included in a prognostic signature called ALPS, which consisted of seven AME-related lncRNAs [PMC9660327]. Co-expression analysis showed that ARHGAP31-AS1 was co-expressed with five AME-associated genes [PMC9660327]. Additionally, qRT-PCR results indicated that the expression of ARHGAP31-AS1 was similar between tumor and normal tissue [PMC9660327].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGCCCCAGCCUAGAGGGGCGCUCGAGGGGAAGCGAGUGAAGUGAGGGCUCCGCCAGAGCAGCACCCCCUUCCCCGCCGUCCCUCCCGGACUGGCCGGUUCUCGUCAGAGAUUCCUUUGUCUUCGACGCUGGUCCCUCCACACCAAGAUGAAGAAAUUGAGAAACAGAAAGUAUGAUGAUUUGCUUAAGACCAGAUGACAAUUAUCUGCAGAAUGAAGACAAUCCUGACCUCCAUCAGUGGAUCCCUUCGCCACCUCCACAGUCUCCCCAUUGCAUGGACACAGACACAUGACAGAUGCACACAUAUGUGCAAAACACUUAUACAGAACACACUCCUCCACCUCCACCUCACUACCACGCAAUCCCAAGACAGCAUUGCCCUUCUCUGGACCCAGCCACUCGGUCAACACAUAUUUACGAACAUUAUGCUAGGCACUGGCAAUAAAAUAAUGAACACCAGAAGACACAGUUCCUGAGUCUCACAGAGAUGACCCAGGAUCAUUCAGAGUCUAGGAUGAGGCAGGGAUUAGGUGGGGAUGAGGAUGAUAAGAGCAGCGUUGGGGAAGUACAGGAUAAGAUGAGAACACACACCAAGGGCACCUAACUUUUUCUCUGGAGGACCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications