Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MGAT3 antisense RNA 1 (MGAT3-AS1) URS00001B3E73_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MGAT3-AS1: MGAT3-AS1 is an intronic antisense long non-coding RNA that has been investigated for its potential to predict delayed allograft function after kidney transplantation [PMC6791892]. The frequency distribution of MGAT3-AS1 at the first postoperative day has been shown in a figure [PMC6791892]. Receiver-operator characteristics analysis demonstrated that preoperative MGAT3-AS1 can predict delayed graft function, with an AUC of 0.83 and a 95% CI of 0.65 to 1.00 [PMC6791892]. The specific primers used for quantitative real-time RT-PCR to measure MGAT3-AS1 expression were provided in the text [PMC6791892]. The study suggests that MGAT3-AS1 could serve as a potential biomarker for short-term transplantation outcomes in patients with deceased donor kidneys at risk of delayed graft function [PMC7168890]. Furthermore, the levels of MGAT3-AS1 in mononuclear cells during the first postoperative month were shown in a figure, indicating its potential role as a biomarker during this period [PMC6791892]. Lower levels of MGAT3-AS1 may indicate reduced phagocytosis and impaired innate immune response, leading to delayed clearance of impaired renal tissue after transplantation [PMC6791892]. MGAT3-AS1 is known to regulate glycoprotein oligosaccharides in mononuclear cells, which are involved in innate immunity processes [PMC7710814]. In conclusion, MGAT3-AS is an intronic antisense long non-coding RNA that shows promise as a biomarker for predicting delayed allograft function after kidney transplantation and may be involved in regulating glycoprotein oligosaccharides and innate immunity processes [PMC7168890][PMC7710814].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUACUGGUGGUCAUCGGGGACGCAGAUAUGUGUGUCUCCAUUUUGCAGAUGAGGACAUGGAGGCCUCAAGAGGUUAAGUGACUUGCUCAGCCACACACAGCUGAUGGGAAUGAAACAGACGGAAACGGAGACUCCCCAAGCUGACAGGCGGACUACAGAUCUGGGGGUUCUGCUCCAGGCUCAACACAAGUGGCCUGGGCGAGGGAGGGCCUGGUAGACCAUGACACCCAGCAUCGAGGAAUUCUGCUUCCCCAGCAGGCUCAGAAGGAAGAAGUCUGCUUCAGGGGCCAGGCCUGGUCAAAGACUCCAUCUUCCCUGGAUGGCCAGAGUCAAAUCCUUGCAAAUCCCGUUCACCAUGGAGCAGAGACGAGACCUAUGUUACCCAGGCUGUAUGUGAAUUCCUGGACUCAAGCAAUCCUCCCAUCUCAGCCUCGUGAGUAGUUGGGACAAGUCUCACACCACCAUACCCAGCUUAAUUUAAUUUGAAUUUUAAUAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications