Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) microRNA dme-mir-283 precursor URS00001B34FD_7227

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dme-mir-283: Dme-mir-283 is a highly upregulated miRNA in fly cells following alphavirus infection, regardless of the presence of Wolbachia [PMC8402854]. In silico miRNA prediction suggests that dme-mir-283 has the potential to target the 3' untranslated region (3'UTR) of the DmDNMT2 gene [PMC8402854]. It is assumed that dme-mir-283 downregulates DmDNMT2 expression, which is consistent with the expression pattern of this miRNA and its target in adult flies [PMC8402854]. The expression profile of dme-mir-283 does not correlate with dme-mir-304 and dme-mir-12, but there is a correlation between dme-mir-304 and dme-mir-12 [PMC3150300]. Additionally, there is no correlation between dme-mir-283* and either dme-mir-283 itself or other miRNAs in its cluster [PMC3150300]. The expression profiles of several other miRNAs, including dme-mir-100, dme-mir-992, and dme-mir-306, also have low correlation coefficients with profiles of their corresponding miRNAs* [PMC3150300]. Furthermore, the expression profiles of several other miRNAs such as dme-miR305 and 100 have weak correlations with at least one miRNA from their respective clusters [PMC3150300]. References: [PMC8402854] - Schnettler E., Donald C.L., Human S., Watson M., Siu R.W.C., McFarlane M. et al. (2021) Wolbachia restricts alphavirus replication in mosquito cells via competition for methyl donors that fuel virus methyltransferases. PLoS Pathog 17(1): e1008402. [PMC3150300] - Wen J., Mohammed J., Bortolamiol-Becet D., Tsai H., Robine N., Westholm J.O. et al. (2014) Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines. Genome Res 24(7): 1236-1250.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCACACGAUUCUCAAAGGUAAAUAUCAGCUGGUAAUUCUGGGAGCUAAGCCUAAAUAUGAAACACUCGGAAUUUCAGUUGGUAUCGACUUUUUUGAAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications