Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-579-3p URS00001B0D1E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-579: Hsa-mir-579 is an intronic miRNA that is associated with the TP53 gene and has been found to alter the binding sites of various miRNAs, including hsa-miR-1224-5p and hsa-miR-1265 [PMC8956157]. It has been suggested that differential intronic miRNA processing may be one mechanism of regulation [PMC4370670]. The binding site for hsa-mir-579 is located in the longest UTR isoform of its host gene, ZFR, at nucleotide position 1301 after the CDS [PMC4370670]. Experimental validation of the direct binding and targeting of hsa-mir-579 to ZFR has been performed using a subcloned 32UTR in a vector [PMC4370670]. Hsa-mir-579 does not have an individual promoter region and appears to be co-expressed with its host gene [PMC4370670]. It has been found to be related to bevacizumab-induced cardiotoxicity, but its expression in the human brain and neuronal function have not yet been described [PMC6195525]. Hsa-mir-579 has also been identified as one of the top altered miRNAs after IL-1β exposure in A549 cells [PMC5349881]. It has shown a modest relative increase in expression in AD PBMCs, along with other miRNAs such as hsa-miR-34a and hsa-miR-155 [PMC4053778]. Additionally, it has been identified as one of several differential miRNAs associated with low and high TMB in LIHC patients [PMC7355149]. Hsa-mir-579 has also been reported to inhibit the transcription of its host gene ZRF by binding to its 3'-UTR [PMC8408170], and it has been predicted to bind with circ_0088300 [PMC8188357]. Furthermore, it has been identified as one of the miRNAs predicted to interact with ANXA2 mRNA [PMC5950137]. Finally, hsa-mir-579 has been found to target multiple genes, including SPRY2, YBX2, and GNAS family proteins [PMC5776763][PMC4786758].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAUUUGGUAUAAACCGCGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications