Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-212 URS00001AFC71_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-212: Bta-mir-212 is a microRNA that has been studied in various contexts. In SF groups, the expression level of bta-mir-212 was found to be increased, along with other miRNAs such as bta-miR-449a, bta-miR-449c, bta-miR-222, bta-miR-21-3p, and bta-miR-155 [PMC4156418]. It is one of the most polymorphic pre-miRNA regions in cattle [PMC4379384]. Bta-mir-212 is transcribed from the intergenic region of chromosome 19 in the bovine genome and shares the same seed region as bta-miR-132 [PMC4438052]. In granulosa cells of preovulatory dominant follicles, both bta-mir-212 and bta-miR-132 were found to be robustly expressed [PMC4438052]. These miRNAs were significantly enriched in preovulatory dominant follicles compared to subordinate follicles [PMC4438052]. Bta-mir-212 was also found to be expressed in lower gut tissues and may serve as a potential diagnostic biomarker for early MAP infection [PMC6371894] [PMC6600136]. In MDMs infected with MAP, both bta-mir-212 and another miRNA called bta-miR677 showed increased expression levels compared to uninfected cells. These miRNAs have not been previously reported in studies on MAP infection in bovines [PMC6600136]. Overall, these findings highlight the importance of studying the role of microRNAs like bta-mir 212 in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCUUGGCUCUAGACUGCUUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

Publications