v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Taeniopygia guttata (zebra finch) Tgu-Mir-132-P2_5p (mature (guide)) URS00001AFC71_59729

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Taeniopygia guttata. Annotated by 1 database (MirGeneDB). Found in the Taeniopygia guttata reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    ACCUUGGCUCUAGACUGCUUACU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 29 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-132-P2_5p (mature (co-guide))
    2. Anolis carolinensis (green anole) Aca-Mir-132-P2_5p (mature (guide))
    3. Bos taurus bta-miR-212
    4. Canis lupus familiaris cfa-miR-212
    5. Cavia porcellus cpo-miR-212-5p
    6. Cricetulus griseus cgr-miR-212
    7. Danio rerio dre-miR-212-5p
    8. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-132-P2_5p (mature (guide))
    9. Gallus gallus (chicken) gga-miR-212-5p
    10. Gekko japonicus Gja-Mir-132-P2_5p (mature (co-guide))
    11. Homo sapiens hsa-miR-212-5p
    12. Ictalurus punctatus (channel catfish) ipu-miR-212
    13. Latimeria chalumnae (coelacanth) Lch-Mir-132-P2_5p (mature (co-guide))
    14. Lepisosteus oculatus (spotted gar) Loc-Mir-132-P2_5p (mature (guide))
    15. Macaca mulatta (Rhesus monkey) mml-miR-212-5p
    16. Microcaecilia unicolor Mun-Mir-132-P2_5p (mature (co-guide))
    17. Monodelphis domestica (gray short-tailed opossum) mdo-miR-212-5p
    18. Mus musculus mmu-miR-212-5p
    19. Neolamprologus brichardi nbr-miR-212b
    20. Oryctolagus cuniculus ocu-miR-212-5p
    21. Pteropus alecto (black flying fox) pal-miR-212-5p
    22. Python bivittatus pbv-miR-212-5p
    23. Rattus norvegicus (Norway rat) Rno-Mir-132-P2_5p (mature (co-guide))
    24. Salmo salar ssa-miR-212b-5p
    25. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-132-P2_5p (mature (co-guide))
    26. Sphenodon punctatus (tuatara) Spt-Mir-132-P2_5p (mature (co-guide))
    27. Sus scrofa (pig) ssc-miR-212
    28. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-132-P2a_5p (mature (co-guide))
    29. Xenopus laevis Xla-Mir-132-P2c_5p (mature (guide))
    30. Xenopus tropicalis Xtr-Mir-132-P2_5p (mature (co-guide))