Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-92b-5p URS00001A7F58_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-92b: Hsa-mir-92b is a microRNA that has been found to be closely associated with colon neoplasms, along with other microRNAs such as hsa-mir-199a and hsa-mir-200a [PMC9088870]. These microRNAs have been predicted to be linked to colon tumors in various analyses, including PBMDA, MCMDA, and EGBMMDA [PMC9088870]. In a case analysis of RLSMDA, hsa-mir-92b and hsa-mir-200a were specifically identified as being associated with colon neoplasms [PMC9088870]. However, there are still five microRNAs that have not been verified in relation to colon neoplasms: hsa-mir-199a, hsa-mir-92b, hsa-mir-200a, hsa-mir-373, and hsa-mir-216b [PMC9088870]. MicroRNAs are small non-coding RNA molecules that play important roles in gene regulation and have been implicated in various diseases including cancer [PMC9088870]. The identification of specific microRNAs associated with colon neoplasms can provide valuable insights into the molecular mechanisms underlying the development and progression of this disease. Understanding the role of these microRNAs can potentially lead to the development of novel diagnostic markers or therapeutic targets for colon cancer. Overall, the research suggests that hsa-mir-92b is closely related to colon neoplasms along with other microRNAs such as hsa-mir-199a and has potential implications for understanding the pathogenesis of this disease. However, further studies are needed to validate these findings and explore their functional significance in relation to colon cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGGACGGGACGCGGUGCAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications