Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila ananassae microRNA dan-mir-9c precursor secondary structure diagram

Drosophila ananassae microRNA dan-mir-9c precursor URS00001A24A5_7217

Automated summary: This pre miRNA sequence is 92 nucleotides long and is found in Drosophila ananassae. Annotated by 3 databases (Ensembl Metazoa, miRBase, ENA). Described in 3 papers. Has a conserved secondary structure or a structured region. Drosophila ananassae microRNA dan-mir-9c precursor sequence is a product of 9c precursor RNA, mir-9c precursor RNA, 9c precursor RN, Dana\mir-9c, FBgn0251067 genes. Found in the Drosophila ananassae reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUUUUUGCUGUUUCUUUGGUAUUCUAGCUGUAGAUUGUUUCACGCACAUUGUAUAUCAUCUAAAGCUUUUAUACCAAAGCUCCAGCUUAAAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 21 other species

    1. Drosophila melanogaster microRNA dme-mir-9c precursor
    2. Drosophila sechellia microRNA dse-mir-9c precursor
    2D structure