Automated summary: This pre miRNA sequence is 92 nucleotides long and is found in Drosophila ananassae. Annotated by 3 databases (Ensembl Metazoa, miRBase, ENA). Described in 3 papers. Has a conserved secondary structure or a structured region. Drosophila ananassae microRNA dan-mir-9c precursor sequence is a product of 9c precursor RNA, mir-9c precursor RNA, 9c precursor RN, Dana\mir-9c, FBgn0251067 genes. Found in the Drosophila ananassae reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AUUUUUGCUGUUUCUUUGGUAUUCUAGCUGUAGAUUGUUUCACGCACAUUGUAUAUCAUCUAAAGCUUUUAUACCAAAGCUCCAGCUUAAAU
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.