Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-274-5p URS00001A1AF6_7227

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dme-mir-274: Dme-mir-274 is a microRNA (miRNA) that plays a central role during embryogenesis/development, as overexpression of dme-mir-274, along with dme-mir-2b and dme-mir-184, resulted in almost total lethality [PMC9100521]. The specific functions of dme-mir-2b and dme-mir-274 in Drosophila are not yet clear [PMC9100521]. However, microarray experiments have shown that both dme-mir-2b and dme-mir-274 are expressed at higher levels in long days compared to short days [PMC9100521]. In fact, seven miRNAs, including dme-mir-2b and dme-mir-274, were found to be differentially expressed between long and short photoperiods [PMC9100521]. These differentially expressed miRNAs (DEMs) were identified through experiments that detected seven DEMs at significant levels (p < 0.01), including dme-mir-2b, dme-mir-11, dme-mir-34, dme-mir-274, dme-miR184*, and 285 [PMC9100521]. To investigate the functional roles of these DEMs in the photoperiodic response of Drosophila diapause (a period of suspended development), overexpression experiments were conducted. Overexpression of specific miRNAs such as DME-MIR 2b, DME-MIR 184*, and DME-MIR 274 using UAS transgenes driven by Act-Gal4 or pdf-Gal4 resulted in changes in photoperiodic diapause [PMC9100521].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGUGACCGACACUAACGGGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Drosophila ananassae Dan-Mir-2001_5p (mature (guide))
Publications