Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-543 URS000019F055_9796

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAACAUUCGCGGUGCACUUCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus bta-miR-543
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-543
  3. Canis lupus familiaris (dog) cfa-miR-543
  4. Cavia porcellus (domestic guinea pig) cpo-miR-543-3p
  5. Cervus elaphus cel-miR-543
  6. Dasypus novemcinctus dno-miR-543-3p
  7. Echinops telfairi Ete-Mir-154-P22_3p (mature (guide))
  8. Homo sapiens hsa-miR-543
  9. Macaca mulatta (Rhesus monkey) mml-miR-543-3p
  10. Mus musculus mmu-miR-543-3p
  11. Oryctolagus cuniculus (rabbit) Ocu-Mir-154-P22_3p (mature (guide))
  12. Pan troglodytes ptr-miR-543
  13. Pongo pygmaeus (Bornean orangutan) ppy-miR-543
  14. Pteropus alecto (black flying fox) pal-miR-543-3p
  15. Rattus norvegicus Rno-Mir-154-P22_3p (mature (guide))
Publications