Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-543 URS000019F055_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-543: Hsa-mir-543 is a microRNA that has been studied in the context of ROC curve analysis [PMC10011472]. According to the analysis, hsa-mir-543 has an AUC (Area Under the Curve) value of 0.7707, indicating its potential as a biomarker [PMC10011472]. In lymphoma, hsa-mir-543 has been found to interact with the gene BRAFP1, competing with BRAF for binding to the same microRNA [PMC6929403]. This interaction suggests a potential role for hsa-mir-543 in lymphoma development and progression [PMC6929403]. However, further research is needed to fully understand its mechanism and significance in lymphoma [PMC6929403]. The AUC values of other microRNAs, such as hsa-miR-506-3p (AUC=0.8039) and hsa-miR-195-5p (AUC=0.7633), have also been determined through ROC curve analysis [PMC10011472]. These findings highlight the potential diagnostic and prognostic value of these microRNAs in various diseases, including lymphoma [PMC10011472]. Understanding the role of specific microRNAs like hsa-mir-543 can provide insights into disease mechanisms and potentially lead to the development of targeted therapies or biomarkers for improved patient management [PMC6929403].

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAACAUUCGCGGUGCACUUCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus bta-miR-543
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-543
  3. Canis lupus familiaris (dog) cfa-miR-543
  4. Cavia porcellus (domestic guinea pig) cpo-miR-543-3p
  5. Cervus elaphus cel-miR-543
  6. Dasypus novemcinctus dno-miR-543-3p
  7. Echinops telfairi Ete-Mir-154-P22_3p (mature (guide))
  8. Equus caballus eca-miR-543
  9. Macaca mulatta (Rhesus monkey) mml-miR-543-3p
  10. Mus musculus mmu-miR-543-3p
  11. Oryctolagus cuniculus (rabbit) Ocu-Mir-154-P22_3p (mature (guide))
  12. Pan troglodytes ptr-miR-543
  13. Pongo pygmaeus (Bornean orangutan) ppy-miR-543
  14. Pteropus alecto (black flying fox) pal-miR-543-3p
  15. Rattus norvegicus Rno-Mir-154-P22_3p (mature (guide))
Publications