Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-543 URS000019F055_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (TarBase, IntAct, MirGeneDB, LncBase, miRBase, RefSeq, ENA, GeneCards). Described in 37 papers. Homo sapiens (human) hsa-miR-543 sequence is a product of miR-543, MIR543, hsa-miR-543 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, ACS3, ACSL3, ADAM22, AGPAT3, AIP1, ALIEN, ANKRD13C, AP-1, ARCN1.

Interactions 6

According to IntAct, Homo sapiens (human) hsa-miR-543 interacts with:

IntAct ID Participant Synonyms
EBI-25596567 intact:EBI-21014881 EBI-21014881 ENST00000256078 mrna_kras
EBI-25596608 intact:EBI-21014881 EBI-21014881 ENST00000256078 mrna_kras
EBI-25596547 intact:EBI-25470264 EBI-25470264 ENST00000403681 mrna_hmga2
EBI-25596598 intact:EBI-25470264 EBI-25470264 ENST00000403681 mrna_hmga2
EBI-25596557 intact:EBI-25596579 EBI-25596579 ENST00000331320 mrna_mta1
EBI-25596618 intact:EBI-25596579 EBI-25596579 ENST00000331320 mrna_mta1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAACAUUCGCGGUGCACUUCUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 14 other species

    1. Bos taurus bta-miR-543
    2. Callithrix jacchus cja-miR-543
    3. Canis lupus familiaris (dog) cfa-miR-543
    4. Cavia porcellus cpo-miR-543-3p
    5. Cervus elaphus cel-miR-543
    6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-543-3p
    7. Echinops telfairi Ete-Mir-154-P22_3p (mature (guide))
    8. Equus caballus eca-miR-543
    9. Macaca mulatta (Rhesus monkey) mml-miR-543-3p
    10. Mus musculus (house mouse) mmu-miR-543-3p
    11. Oryctolagus cuniculus (rabbit) Ocu-Mir-154-P22_3p (mature (guide))
    12. Pan troglodytes (chimpanzee) ptr-miR-543
    13. Pongo pygmaeus ppy-miR-543
    14. Pteropus alecto (black flying fox) pal-miR-543-3p
    15. Rattus norvegicus (Norway rat) Rno-Mir-154-P22_3p (mature (guide))