Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) ppy-miR-708 URS000019D79B_9600

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Pongo pygmaeus. Annotated by 1 database (miRBase).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AAGGAGCUUACAAUCUAGCUGGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 18 other species

    1. Bos taurus bta-miR-708
    2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-708
    3. Canis lupus familiaris cfa-miR-708
    4. Capra hircus (goat) chi-miR-708-5p
    5. Cavia porcellus cpo-miR-708-5p
    6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-708-5p
    7. Echinops telfairi Ete-Mir-28-P3_5p (mature (co-guide))
    8. Equus caballus eca-miR-708
    9. Homo sapiens hsa-miR-708-5p
    10. Macaca mulatta (Rhesus monkey) mml-miR-708-5p
    11. Microcebus murinus (gray mouse lemur) mmr-miR-708
    12. Mus musculus mmu-miR-708-5p
    13. Oryctolagus cuniculus ocu-miR-708-5p
    14. Pan troglodytes ptr-miR-708
    15. Papio hamadryas (hamadryas baboon) pha-miR-708
    16. Rattus norvegicus (Norway rat) rno-miR-708-5p
    17. Sus scrofa (pig) ssc-miR-708-5p
    18. Tupaia chinensis (Chinese tree shrew) tch-miR-708-5p