Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Lemur catta (Ring-tailed lemur) lca-miR-16 URS00001996C3_9447

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCACGUAAAUAUUGGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Alligator mississippiensis ami-miR-16a-5p
  2. Bos taurus bta-miR-16a
  3. Cavia porcellus (domestic guinea pig) cpo-miR-16a-5p
  4. Chrysemys picta (Painted turtle) cpi-miR-16b-5p
  5. Columba livia (rock pigeon) Cli-Mir-15-P2a_5p (mature (guide))
  6. Cyprinus carpio (common carp) ccr-miR-16a
  7. Danio rerio (zebrafish) dre-miR-16a
  8. Dasypus novemcinctus dno-miR-16a-5p
  9. Echinops telfairi Ete-Mir-15-P2a_5p (mature (guide))
  10. Gadus morhua Gmo-Mir-15-P2b_5p (mature (guide))
  11. Gallus gallus (chicken) gga-miR-16-5p
  12. Gekko japonicus Gja-Mir-15-P2b_5p (mature (guide))
  13. Microcaecilia unicolor Mun-Mir-15-P2b_5p (mature (guide))
  14. Monopterus albus Mal-Mir-15-P2b_5p (mature (guide))
  15. Mus musculus Mus_musculus piRNA piR-mmu-48917274
  16. Ophiophagus hannah oha-miR-16b-5p
  17. Ornithorhynchus anatinus (platypus) oan-miR-16b-5p
  18. Python bivittatus (Burmese python) pbv-miR-16b-5p
  19. Salmo salar ssa-miR-16b-5p
  20. Sphenodon punctatus (tuatara) Spt-Mir-15-P2b_5p (mature (guide))
  21. Taeniopygia guttata (zebra finch) tgu-miR-16a-5p
  22. Tor tambroides miR-16a
  23. Xenopus tropicalis xtr-miR-16a