Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Alligator mississippiensis (American alligator) ami-miR-16a-5p URS00001996C3_8496

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Alligator mississippiensis. Annotated by 2 databases (miRBase, MirGeneDB).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAGCAGCACGUAAAUAUUGGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 23 other species

    1. Bos taurus bta-miR-16a
    2. Cavia porcellus cpo-miR-16a-5p
    3. Chrysemys picta cpi-miR-16b-5p
    4. Columba livia Cli-Mir-15-P2a_5p (mature (guide))
    5. Cyprinus carpio ccr-miR-16a
    6. Danio rerio dre-miR-16a
    7. Dasypus novemcinctus dno-miR-16a-5p
    8. Echinops telfairi Ete-Mir-15-P2a_5p (mature (guide))
    9. Gadus morhua Gmo-Mir-15-P2b_5p (mature (guide))
    10. Gallus gallus gga-miR-16-5p
    11. Gekko japonicus Gja-Mir-15-P2b_5p (mature (guide))
    12. Lemur catta (Ring-tailed lemur) lca-miR-16
    13. Microcaecilia unicolor Mun-Mir-15-P2b_5p (mature (guide))
    14. Monopterus albus Mal-Mir-15-P2b_5p (mature (guide))
    15. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-48917274
    16. Ophiophagus hannah oha-miR-16b-5p
    17. Ornithorhynchus anatinus (platypus) oan-miR-16b-5p
    18. Python bivittatus (Burmese python) pbv-miR-16b-5p
    19. Salmo salar ssa-miR-16b-5p
    20. Sphenodon punctatus (tuatara) Spt-Mir-15-P2b_5p (mature (guide))
    21. Taeniopygia guttata tgu-miR-16a-5p
    22. Tor tambroides miR-16a
    23. Xenopus tropicalis (tropical clawed frog) xtr-miR-16a