Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 26 (SNORD26) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 26 (SNORD26) URS0000197BB5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD26: SNORD26 is a C/D box small nucleolar RNA (snoRNA) that is located within the inside-out gene SNHG1 and is one of the eight C/D box snoRNAs hosted by SNHG1 [PMC4378963]. Dysfunction of SNORD26, along with SNORD44 and SNORD78, has been shown to result in severe morphological abnormalities and embryonic death [PMC10102602]. The intracellular level of SNHG1, which hosts SNORD26, can be repressed by p53 activation [PMC7154078]. The expression of SNORD26 has been found to be increased in chondrocytes isolated from osteoarthritis (OA) cartilage [PMC7326970]. Knockdown of SNORD26 in primary human articular chondrocytes (HACs) has been shown to alter the expression of chondrogenic, hypertrophic, and OA-related genes [PMC7326970]. Overexpression of SNORD26 in primary chondrocytes also leads to changes in gene expression related to chondrogenesis and OA [PMC7326970]. Additionally, differential expression of SNORD26 has been found to be predominantly OA-related [PMC7326970]. The expression level of SNORD26 has also been found to increase in osteoarthritis cartilage compared to non-OA cartilage [PMC9127141]. Mechanistic analysis suggests that both SNORD26 and another snoRNA called SNORD96A are involved in determining the chondrocyte phenotype [PMC8638817]. Overall, these findings highlight the importance of snoRNA such as SNORD26 in regulating gene expression and cellular processes related to cartilage development and osteoarthritis.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUACGGGGAUGAUUUUACGAACUGAACUCUCUCUUUCUGAUGGAUUAGUGGAGAAAACAGAAAAUUCUGAGUAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications