Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-544a URS00001934CD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-544a: Hsa-mir-544a is a microRNA (miRNA) that has been identified in various studies. It has been found to be present in different lists of miRNAs, such as in a comparison of two lists where it was one of the 17 miRNAs found to be in common [PMC8279534]. In another study, hsa-mir-544a was used as a case study to verify the ability of DWLMI (DeepWalk-based LncRNA-MiRNA Interaction prediction) in predicting potential lncRNA-miRNA associations [PMC8875942]. The expression of hsa-mir-544a was also found to be significantly different in certain groups, such as in the IM group compared to the NC group [PMC7052922]. Furthermore, hsa-mir-544a was included in an ESCC-specific circRNA-associated ceRNA network constructed using Cytoscape software [PMC7474783]. In another study, hsa-mir-544a was one of the 17 host miRNAs identified that have the capacity to interact with SARS-CoV-2 genome and can be regulated by polyphenols [PMC9346380]. Additionally, a SNP (rs10144193) in hsa-mir-544a was selected from preliminary results for further analysis [PMC9137639]. Overall, hsa-mir-544a has been implicated and studied in various contexts and is considered an important miRNA.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUUCUGCAUUUUUAGCAAGUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Bos taurus bta-miR-544a
  2. Callithrix jacchus cja-miR-544
  3. Canis lupus familiaris (dog) cfa-miR-544
  4. Equus caballus (horse) eca-miR-544
  5. Macaca mulatta mml-miR-544
  6. Pan troglodytes (chimpanzee) ptr-miR-544
  7. Pongo pygmaeus ppy-miR-544
Publications