Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-200c-3p URS0000192F9C_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, ENA, PirBase, LncBase, MirGeneDB, TarBase, miRBase). Described in 40 papers. Mus musculus (house mouse) mmu-miR-200c-3p sequence is a product of Mir200c, miR-200c, miR-200, mmu-miR-200c-3p, mmu-miR-200c, miR-200c-3p genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1700120C01Rik, 2010320B01Rik, 2810009A20Rik, 3110032K11Rik, 4833427O07Rik, 5730445M16Rik, 5830447M11Rik, 9130203F04Rik, 9430057O19Rik, AREB6.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAAUACUGCCGGGUAAUGAUGGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 27 other species

    1. Bos taurus (cattle) bta-miR-200c
    2. Callithrix jacchus cja-miR-200c
    3. Canis lupus familiaris cfa-miR-200c
    4. Capra hircus chi-miR-200c
    5. Cavia porcellus (domestic guinea pig) cpo-miR-200c-3p
    6. Cervus elaphus (red deer) cel-miR-200c
    7. Cricetulus griseus cgr-miR-200c
    8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-8-P2b_3p (mature (guide))
    9. Eptesicus fuscus (big brown bat) efu-miR-200c
    10. Equus caballus (horse) eca-miR-200c
    11. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-384324
    12. Homo sapiens hsa-miR-200c-3p
    13. Macaca mulatta Mml-Mir-8-P2b_3p (mature (guide))
    14. Monodelphis domestica Mdo-Mir-8-P2b_3p (mature (guide))
    15. Oryctolagus cuniculus (rabbit) ocu-miR-200c-3p
    16. Pan troglodytes (chimpanzee) ptr-miR-200c
    17. Pteropus alecto pal-miR-200c-3p
    18. Rattus norvegicus Rno-Mir-8-P2b_3p (mature (guide))
    19. Tupaia chinensis tch-miR-200c-3p