v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Down syndrome critical region 10 (DSCR10) URS000018E2F9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

DSCR10: DSCR10 is a long non-coding RNA (lncRNA) that has been identified as a potential biomarker for the prognosis of patients with lung adenocarcinoma (LUAD) [PMC7523091]. However, there is limited research on the function of DSCR10 in cancer [PMC7523091]. In addition to DSCR10, other lncRNAs such as DISC1-IT1 and SYNPR-AS1, as well as miRNA hsa-mir-31, have also been associated with LUAD prognosis [PMC7523091]. These lncRNAs and miRNA have the potential to serve as biomarkers for LUAD prognosis [PMC7523091]. Furthermore, DSCR9 and DSCR10 are genes that are exclusive to primates and are not found in non-primate mammals [PMC9348576]. These genes have been identified in primates such as chimpanzees, gorillas, orangutans, crab-eating monkeys, and African green monkeys [PMC9348576]. Overall, while there is limited research on the function of DSCR10 in cancer specifically, it has been identified as a potential biomarker for LUAD prognosis. Additionally, DSCR9 and DSCR10 are genes exclusive to primates. Further studies are needed to fully understand the role of these genes in cancer and other biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGCAACCAGGAUAGAAGAUCAGUUGUGCUGGGGGAGGGGAGCCAGCCAGGUUGUAGAAACAGCAUCCCUGACUUUGUUCUGCUAACUGUGCAGAGAGAGGUGAUAGUCUCCGCCCAGGCCAUGAGGGACCUGGAAAUGGCUGAUGACACGGUGGAGCUCGGCCACACCAGGCCCAGCUGGCCCCACAGCAAACCAGAGGGUCCAAGGAAGCUGGGUCCUGCCCACCAAGGUCCCAGGGAUCCUCCUCUGAGGCCCCCUCUCUCCUUUGGGUUUAGUCAACGGAGAGGGAGAUGGGGAGAGGACUGAAAGGUCUCCCCAAAGGUACAAGCUGAGAGACCUGGAUUUGCAAUCAGACAGCUCACAUGGACCCAAGUUGGGGUUAACAUGCAGAUUGUGCAGGGGUUCCCUGCGGAUGCACCCCUGUGUGCCCUGAUGUGGACCUGCUCCUUCCUGCUUCCUGGGCUCCAGACAGAAACACCGUACCCCUGCACCAGCCUCUGCCUCAGCUCUUCACAGUCAGCACACCCUCCGCUUCCUGUCAGGGUGUUCUCUGCUGAGUCUGGUUAUGGGAUCCCUUUCUGUGCAGAGCCAUGCUCCCGUGUCACUGUGUGUCACCUUCAAGCUGUCCCCGUGUGUAUGCCUGUGUGAGAAUAUGUGUGUGUGGGUUUGCCAUCGAAGGAAAACCUUUAUUUUGGCUGCUAACAUUUGGAAACAUUUAGAGAACAAACAAUAUCUUUUAAAAAACAUCAAAGGUUCAAAAAAACAAGACAAGAAACAAACUGUUGUAAAAUUUCAACUCCUCUAAAUUUGUCUUAAAUUGAACUUAGAACUAAUCUAAUAAAAAUAGUAUGAAGUUUCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications