Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MAFA antisense RNA 1 URS000018A52D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MAFA-AS1: MAFA-AS1 is a long non-coding RNA (lncRNA) that has not been previously reported to be related to hepatocellular carcinoma (HCC) biology, and its functions and mechanisms in HCC need further investigation [PMC7377850]. A study found that MAFA-AS1 is correlated with hsa-miR-210, an oncogenic miRNA in many cancers [PMC8798454]. MAFA-AS1 has been shown to distinguish early-stage HCC patients from advanced stage patients and is associated with worse outcomes in HCC [PMC8798454]. It interacts with RNA-binding proteins SRSF1 and SRSF9, potentially affecting DNA replication and the cell cycle [PMC8798454]. Additionally, MAFA-AS1 interacts with miR210 and affects DNA replication and the cell cycle through GO and KEGG analyses [PMC8798454]. MAFA-AS1 has a stable secondary structure [PMC8798454]. It is not believed to affect neighboring genes through spatial interactions but may regulate other oncogenes or tumor suppressors in HCC [PMC8798454]. Furthermore, MAFA-AS1 has been identified as a prognostic marker for HCC, as its high expression predicts poor overall survival (OS) and disease-free survival (DFS) rates in patients with HCC [PMC8798454]. In other cancer types such as diffuse large B-cell lymphoma (DLBCL), MAFA-AS1 has also been associated with poor prognosis [PMC7298280][PMC8668967][PMC9641000][PMC9187470].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAUCCUGCUUUCCUUUUCUUUCUUUUCAACAAAUAUUGAUGGAGCACCUCCUCGGUGCCAGGCGCUGCUGCAGCCUCUAGGAAAUCAACCGUGGAAACACACGGACCCUGCCCUCCCGGCGCCAGUGUUCUGGUGGUCAGGAGGUGAAGAAAACCAGCAAGAACCAGCACAGGAAUCCGACGGUGGCAGCGCCGAGAGAAACAAGCUUGGAGGGGAAGGAGAGCUACAGAGGCUGCAUGGAUGUGAUGGUUGGAGUGGAAGCUGACAUUGUGGGCCAGGAGACCCUGGGAGUACAGGCCAAGAUGAAAAGAGCCUCAAUCCAGAGCGUUCUGUGAAGCAGUCACCACGGCCACCCUGGGCCAUCAGCUUCUGGACUUUUACAACAUAGAAAUUAAAUUUCCAUUGAAUUUGUUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications