Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR169i-5p.2 URS000018983F_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR169i-5p.2: Osa-mir169i-5p.2 is a member of the miR169 family and is significantly downregulated in both 9311 and DC90 under chilling stress. However, its downregulation level in 9311 is lower than in DC90 [PMC9002458]. Under chilling stress, the expression levels of osa-miR5340, osa-mir169i-5p.2, and osa-miR159a.2 are downregulated, while their predicted target genes (LOC_Os03g15780, LOC_Os05g40720, LOC_Os04g51160, and LOC_Os05g01440) are consistently upregulated [PMC9002458]. Other differentially expressed miRNAs (DEMs) also show significant expression changes under chilling stress. For example, novel_miR_233 and novel_miR_390 are significantly upregulated while osa-mir169i-5p.2 is significantly downregulated in both genotypes [PMC9002458]. In a recent study focusing on root development in rice, osa-mir169i-5p.2 is found to have high abundance in root tips [PMC5447883]. Additionally, a large number of sRNAs including miRNA sequences such as osa-mir169i-5p.2 show high abundances in root tips and whole roots [PMC3734165]. Overall, these findings suggest that osa-mir169i-5p.2 plays an important role under chilling stress and in root development of rice [PMC9002458][PMC5447883][PMC3734165].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUGAUAAGGGUGUAGCUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Oryza sativa Japonica Group microRNA osa-miR169i-5p.2
Publications