Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-224 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-224 precursor URS0000184017_9606

  • 81 nucleotides
  • 9 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq, Rfam)
  • Found in 19 species

Automated summary: This pre miRNA sequence is 81 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (Ensembl, RefSeq, MalaCards, HGNC, miRBase, Rfam, ENA, Ensembl/GENCODE, GeneCards). Described in 50 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-224, RF00680). Homo sapiens (human) microRNA hsa-mir-224 precursor sequence is a product of hsa-mir-224 precursor, mir-224, mir-224 precursor, mir-224 precurso, MIR224, 224 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 18 other species

    1. Cercocebus atys (Sooty mangabey) miRNA
    2. Chlorocebus sabaeus (African green monkey) miRNA
    3. Colobus angolensis palliatus microRNA 224
    4. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-224
    5. Gorilla gorilla microRNA ggo-mir-224 precursor
    6. Macaca fascicularis miRNA
    7. Macaca mulatta microRNA mml-mir-224 precursor
    8. Macaca nemestrina microRNA mne-mir-224 precursor
    9. Mandrillus leucophaeus (Drill) miRNA
    10. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    11. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-224 precursor
    12. Pan troglodytes (chimpanzee) microRNA ptr-mir-224 precursor
    13. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 224
    14. Pongo abelii microRNA 224
    15. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-224 precursor
    16. Rhinopithecus bieti miRNA
    17. Rhinopithecus roxellana microRNA 224
    18. Theropithecus gelada microRNA 224
    19. Vicugna pacos (alpaca) miRNA
    2D structure New