Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) miscellaneous RNA URS0000183BED_9940

Automated summary: This misc RNA sequence is 21 nucleotides long and is found in Ovis aries. Annotated by 1 database (ENA). Found in the Ovis aries reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AUCACAUUGCCAGGGAUUACC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 29 other species

    1. Anolis carolinensis aca-miR-23b-3p
    2. Callithrix jacchus cja-miR-23b
    3. Callorhinchus milii (elephant shark) eshark_mir-23_1
    4. Capra hircus (goat) chi-miR-23b-3p
    5. Chiloscyllium plagiosum microRNA cpl-miR-23b
    6. Chrysemys picta cpi-miR-23b-3p
    7. Cricetulus griseus (Chinese hamster) cgr-miR-23b-3p
    8. Cyprinus carpio ccr-miR-23b
    9. Daubentonia madagascariensis dma-miR-23b
    10. Equus caballus eca-miR-23b
    11. Gallus gallus gga-miR-23b-3p
    12. Haplochromis burtoni abu-miR-23b
    13. Homo sapiens hsa-miR-23b-3p
    14. Ictalurus punctatus (channel catfish) ipu-miR-23b
    15. Macaca mulatta mml-miR-23b-3p
    16. Maylandia zebra (zebra mbuna) mze-miR-23b
    17. Microcebus murinus (gray mouse lemur) mmr-miR-23b
    18. Monodelphis domestica mdo-miR-23b-3p
    19. Mus musculus (house mouse) mmu-miR-23b-3p
    20. Neolamprologus brichardi nbr-miR-23b
    21. Nomascus leucogenys nle-miR-23b
    22. Oreochromis niloticus (Nile tilapia) oni-miR-23b
    23. Papio hamadryas pha-miR-23b
    24. Pundamilia nyererei pny-miR-23b
    25. Rattus norvegicus rno-miR-23b-3p
    26. Taeniopygia guttata tgu-miR-23-3p
    27. Tursiops truncatus (common bottlenose dolphin) miR-23b
    28. Xenopus laevis xla-miR-23b-3p
    29. Xenopus tropicalis (tropical clawed frog) xtr-miR-23b