Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-23b-3p URS0000183BED_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-23b: Gga-mir-23b is a microRNA that has been reported to be associated with tumorigenesis and the aberrant expression of the retrovirus, ALV-J [PMC5276853]. The bulge-loop RT primer and qPCR primers specific for gga-mir-23b were designed and synthesized [PMC4434839]. Gga-mir-23b has been found to target interferon regulatory factor 1 (IRF1), a critical regulatory protein of the inflammatory response that functions as a tumor suppressor and is involved in cell cycle progression and apoptosis [PMC7063076]. Overexpression of gga-mir-23b resulted in increased expression of gp85, while overexpression of IRF1 caused a decrease in gp85 level [PMC7063076]. Gga-mir-23b promotes the replication of Avian Leukosis virus by repressing the expression of IRF1 [PMC6627052]. It has also been found to be more expressed in the spleen of ALV-J-infected chickens compared to controls, suggesting its important role in ALV-J replication [PMC6862082]. Additionally, gga-mir-23b was found to be expressed at high levels in IAH30 cells along with other miRNAs such as gga-miR-24, gga-miR-27b, gga-miR-19b, gga-miR-20a, gga-miR-148a, and gga-miR92 [PMC3743212]. The enrichment of targets for other miRNAs including gga-miR9*, ggammiR217, ggami-R19a was also significant [PMC5657028].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCACAUUGCCAGGGAUUACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Anolis carolinensis aca-miR-23b-3p
  2. Callithrix jacchus cja-miR-23b
  3. Callorhinchus milii (elephant shark) eshark_mir-23_1
  4. Capra hircus (goat) chi-miR-23b-3p
  5. Chiloscyllium plagiosum microRNA cpl-miR-23b
  6. Chrysemys picta cpi-miR-23b-3p
  7. Cricetulus griseus cgr-miR-23b-3p
  8. Cyprinus carpio (common carp) ccr-miR-23b
  9. Daubentonia madagascariensis (aye-aye) dma-miR-23b
  10. Equus caballus eca-miR-23b
  11. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-23b
  12. Homo sapiens (human) hsa-miR-23b-3p
  13. Ictalurus punctatus (channel catfish) ipu-miR-23b
  14. Macaca mulatta (Rhesus monkey) mml-miR-23b-3p
  15. Maylandia zebra (zebra mbuna) mze-miR-23b
  16. Microcebus murinus (gray mouse lemur) mmr-miR-23b
  17. Monodelphis domestica mdo-miR-23b-3p
  18. Mus musculus (house mouse) mmu-miR-23b-3p
  19. Neolamprologus brichardi (lyretail cichlid) nbr-miR-23b
  20. Nomascus leucogenys nle-miR-23b
  21. Oreochromis niloticus oni-miR-23b
  22. Ovis aries miscellaneous RNA
  23. Papio hamadryas pha-miR-23b
  24. Pundamilia nyererei pny-miR-23b
  25. Rattus norvegicus rno-miR-23b-3p
  26. Taeniopygia guttata (zebra finch) tgu-miR-23-3p
  27. Tursiops truncatus (common bottlenose dolphin) miR-23b
  28. Xenopus laevis (African clawed frog) xla-miR-23b-3p
  29. Xenopus tropicalis xtr-miR-23b
Publications