Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) mdo-miR-23b-3p URS0000183BED_13616

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Monodelphis domestica. Annotated by 3 databases (miRBase, RefSeq, ENA). Described in 5 papers. Monodelphis domestica (gray short-tailed opossum) mdo-miR-23b-3p sequence is a product of mdo-miR-23b, miR-23, MIR23B, mdo-miR-23b-3p, miR-23b-3p, miR-23b genes. Found in the gray short-tailed opossum reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUCACAUUGCCAGGGAUUACC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 52 other species

    1. Anolis carolinensis aca-miR-23b-3p
    2. Callithrix jacchus cja-miR-23b
    3. Callorhinchus milii (elephant shark) eshark_mir-23_1
    4. Capra hircus chi-miR-23b-3p
    5. Chiloscyllium plagiosum microRNA cpl-miR-23b
    6. Chrysemys picta (Painted turtle) cpi-miR-23b-3p
    7. Cricetulus griseus cgr-miR-23b-3p
    8. Cyprinus carpio ccr-miR-23b
    9. Daubentonia madagascariensis (aye-aye) dma-miR-23b
    10. Equus caballus (horse) eca-miR-23b
    11. Gallus gallus (chicken) gga-miR-23b-3p
    12. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-23b
    13. Homo sapiens hsa-miR-23b-3p
    14. Ictalurus punctatus (channel catfish) ipu-miR-23b
    15. Macaca mulatta mml-miR-23b-3p
    16. Maylandia zebra mze-miR-23b
    17. Microcebus murinus mmr-miR-23b
    18. Mus musculus (house mouse) mmu-miR-23b-3p
    19. Neolamprologus brichardi nbr-miR-23b
    20. Nomascus leucogenys nle-miR-23b
    21. Oreochromis niloticus oni-miR-23b
    22. Ovis aries miscellaneous RNA
    23. Papio hamadryas (hamadryas baboon) pha-miR-23b
    24. Pundamilia nyererei pny-miR-23b
    25. Rattus norvegicus rno-miR-23b-3p
    26. Taeniopygia guttata (zebra finch) tgu-miR-23-3p
    27. Tursiops truncatus miR-23b
    28. Xenopus laevis (African clawed frog) xla-miR-23b-3p
    29. Xenopus tropicalis xtr-miR-23b