Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-23b-3p URS0000183BED_10116

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Rattus norvegicus. Annotated by 3 databases (miRBase, PirBase, RefSeq). Rattus norvegicus (Norway rat) rno-miR-23b-3p sequence is a product of Mir23b, miR-23b-3p, rno-miR-23b-3p, miR-23b, rno-miR-23b, miR-23 genes. Found in the norway rat reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AUCACAUUGCCAGGGAUUACC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 29 other species

    1. Anolis carolinensis aca-miR-23b-3p
    2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-23b
    3. Callorhinchus milii (elephant shark) eshark_mir-23_1
    4. Capra hircus chi-miR-23b-3p
    5. Chiloscyllium plagiosum microRNA cpl-miR-23b
    6. Chrysemys picta (Painted turtle) cpi-miR-23b-3p
    7. Cricetulus griseus cgr-miR-23b-3p
    8. Cyprinus carpio ccr-miR-23b
    9. Daubentonia madagascariensis (aye-aye) dma-miR-23b
    10. Equus caballus (horse) eca-miR-23b
    11. Gallus gallus gga-miR-23b-3p
    12. Haplochromis burtoni abu-miR-23b
    13. Homo sapiens hsa-miR-23b-3p
    14. Ictalurus punctatus ipu-miR-23b
    15. Macaca mulatta (Rhesus monkey) mml-miR-23b-3p
    16. Maylandia zebra (zebra mbuna) mze-miR-23b
    17. Microcebus murinus mmr-miR-23b
    18. Monodelphis domestica (gray short-tailed opossum) mdo-miR-23b-3p
    19. Mus musculus mmu-miR-23b-3p
    20. Neolamprologus brichardi nbr-miR-23b
    21. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-23b
    22. Oreochromis niloticus oni-miR-23b
    23. Ovis aries miscellaneous RNA
    24. Papio hamadryas (hamadryas baboon) pha-miR-23b
    25. Pundamilia nyererei pny-miR-23b
    26. Taeniopygia guttata tgu-miR-23-3p
    27. Tursiops truncatus miR-23b
    28. Xenopus laevis xla-miR-23b-3p
    29. Xenopus tropicalis (tropical clawed frog) xtr-miR-23b
    Publications New