Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-23b-3p URS0000183BED_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-23b: Mmu-mir-23b is a microRNA that plays a role in various biological processes. It is involved in the differentiation of primordial germ cells by regulating the Lin28 and Blimp1 genes [PMC9505168]. Mmu-mir-23b is also identified as a differentially expressed microRNA (DEmiRNA) in both neural stem/progenitor cell (NSPC)-induced endothelial cell (EC) alteration and EC-induced NSPC alteration [PMC7758130]. However, its expression patterns differ in these situations [PMC7758130]. Mmu-mir-23b, along with mmu-miR-23a and mmu-miR-210, has been found to be involved in the crosstalk between ECs and NSPCs [PMC7758130]. It has also been implicated as critical for maintaining the glomerular filtration barrier [PMC2658734]. In a study on diet-induced obesity, mmu-mir-23b was found to be downregulated in obese mice compared to lean mice [PMC4571067]. In mice primordial germ cells (PGCs), exposure to vinclozolin during pregnancy led to a decrease in mmu-mir-23b expression, which downregulated the Lin28/let-7/Blimp1 PGC specification pathway across three generations [PMC9563050]. Mmu-mir-23b has a predicted binding site on the 3' untranslated region (3'UTR) of Runx2 mRNA at position 1002–1008 [PMC4768947]. Overall, mmu-mir-23b is involved in germ cell differentiation, crosstalk between ECs and NSPCs, glomerular filtration barrier maintenance, obesity-related miRNA dysregulation, PGC specification pathway regulation by environmental exposure, and potential regulation of Runx2 mRNA [PMC9505168][PMC7758130][PMC2658734][PMC4571067][PMC9563050][PMC4768947].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCACAUUGCCAGGGAUUACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Anolis carolinensis aca-miR-23b-3p
  2. Callithrix jacchus cja-miR-23b
  3. Callorhinchus milii (elephant shark) eshark_mir-23_1
  4. Capra hircus (goat) chi-miR-23b-3p
  5. Chiloscyllium plagiosum microRNA cpl-miR-23b
  6. Chrysemys picta cpi-miR-23b-3p
  7. Cricetulus griseus cgr-miR-23b-3p
  8. Cyprinus carpio (common carp) ccr-miR-23b
  9. Daubentonia madagascariensis (aye-aye) dma-miR-23b
  10. Equus caballus eca-miR-23b
  11. Gallus gallus (chicken) gga-miR-23b-3p
  12. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-23b
  13. Homo sapiens (human) hsa-miR-23b-3p
  14. Ictalurus punctatus (channel catfish) ipu-miR-23b
  15. Macaca mulatta (Rhesus monkey) mml-miR-23b-3p
  16. Maylandia zebra (zebra mbuna) mze-miR-23b
  17. Microcebus murinus (gray mouse lemur) mmr-miR-23b
  18. Monodelphis domestica mdo-miR-23b-3p
  19. Neolamprologus brichardi (lyretail cichlid) nbr-miR-23b
  20. Nomascus leucogenys nle-miR-23b
  21. Oreochromis niloticus oni-miR-23b
  22. Ovis aries miscellaneous RNA
  23. Papio hamadryas pha-miR-23b
  24. Pundamilia nyererei pny-miR-23b
  25. Rattus norvegicus rno-miR-23b-3p
  26. Taeniopygia guttata (zebra finch) tgu-miR-23-3p
  27. Tursiops truncatus (common bottlenose dolphin) miR-23b
  28. Xenopus laevis (African clawed frog) xla-miR-23b-3p
  29. Xenopus tropicalis xtr-miR-23b
Publications