Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) mdo-miR-100-5p URS000017A252_13616

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Monodelphis domestica. Annotated by 3 databases (ENA, miRBase, RefSeq). Monodelphis domestica (gray short-tailed opossum) mdo-miR-100-5p sequence is a product of MIR100, miR-100-5p, miR-100, mdo-miR-100, mdo-miR-100-5p genes. Found in the gray short-tailed opossum reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AACCCGUAGAUCCGAACUUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 74 other species

    1. Capra hircus (goat) chi-miR-100-5p
    2. Cervus elaphus cel-miR-100
    3. Chrysemys picta (Painted turtle) cpi-miR-100-5p
    4. Cricetulus griseus (Chinese hamster) cgr-miR-100-5p
    5. Cyprinus carpio ccr-miR-100
    6. Daubentonia madagascariensis (aye-aye) dma-miR-100
    7. Mus musculus Mus_musculus piRNA piR-mmu-8085145
    8. Patiria miniata pmi-miR-100-5p
    9. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-100
    10. Sarcophilus harrisii (Tasmanian devil) sha-miR-100
    11. Taeniopygia guttata tgu-miR-100-5p
    12. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-1808276
    Publications New