Gorilla gorilla (western gorilla) microRNA ggo-mir-219 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla (western gorilla) microRNA ggo-mir-219 precursor URS0000173F7B_9593

110 nucleotides
2 databases (ENA, miRBase)
Found in 3 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CCGCCCCGGGCCGCGGCUCCUGAUUGUCCAAACGCAAUUCUCGAGUCUAUGGCUCCGGCCGAGAGUUGAGUCUGGACGUCCCGAGCCGCCGCCCCCAAACCUCGAGCGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Gorilla gorilla gorilla microRNA mir-219 (MIR219)
Homo sapiens (human) microRNA hsa-mir-219a precursor (hsa-mir-219a-1)

2D structure