v20

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila willistoni dwi-miR-79 URS0000167E65_7260

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Drosophila willistoni. Annotated by 2 databases (Ensembl Metazoa, miRBase). Drosophila willistoni dwi-miR-79 sequence is a product of FBtr0297828_df_nrg, FBtr0297869_df_nrg genes. Found in the Drosophila willistoni reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UAAAGCUAGAUUACCAAAGCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 77 other species

    1. Aedes aegypti (yellow fever mosquito) aae-miR-79-3p
    2. Anopheles gambiae (African malaria mosquito) aga-miR-79
    3. Bactrocera dorsalis bdo-miR-79
    4. Dasypus novemcinctus Dan-Mir-9-P10-v1_3p (mature (guide))
    5. Drosophila ananassae dan-miR-79
    6. Drosophila erecta der-miR-79
    7. Drosophila grimshawi dgr-miR-79
    8. Drosophila melanogaster dme-miR-79-3p
    9. Drosophila mojavensis dmo-miR-79
    10. Drosophila persimilis dpe-miR-79
    11. Drosophila pseudoobscura dps-miR-79
    12. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294473_df_nrg
    13. Drosophila sechellia dse-miR-79
    14. Drosophila simulans Dsi-Mir-9-P12-v1_3p (mature (guide))
    15. Drosophila virilis dvi-miR-79-3p
    16. Drosophila yakuba dya-miR-79
    17. Heliconius melpomene hme-miR-79