Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Hsa-Mir-186_5p (mature (guide)) URS000015CB3A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-186: Hsa-mir-186 is a human microRNA that is known to be upregulated in response to HIV-1 infection, targeting Dicer-1, HIV-EP2, and HRB, which are involved in various aspects of HIV-1 replication and pathogenesis [PMC9741442]. In addition to its role in HIV infection, hsa-mir-186 has also been implicated in adult T-cell leukemia/lymphoma (ATLL) [PMC8244200]. A primary analysis of microarray datasets revealed that hsa-mir-186 is differentially expressed in ATLL patients compared to normal individuals [PMC8244200]. This suggests that hsa-mir-186 may play a role in the development and progression of ATLL. Other microRNAs such as hsa-let-7a, hsa-let-7g, hsa-mir-181b, hsa-mir26b, hsa-mir30c, hsa-mir10a, hsa-mir30b, and haslet7f were also identified as differentially expressed in ATLL patients [PMC8244200]. These findings highlight the potential importance of microRNAs in the pathogenesis of ATLL and suggest that further investigation into the role of these microRNAs may provide insights into disease mechanisms and potential therapeutic targets.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAAGAAUUCUCCUUUUGGGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Bos taurus Bta-Mir-186_5p (mature (guide))
  2. Canis lupus familiaris (dog) Cfa-Mir-186_5p (mature (guide))
  3. Cavia porcellus cpo-miR-186-5p
  4. Cricetulus griseus (Chinese hamster) cgr-miR-186-5p
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-186-5p
  6. Echinops telfairi Ete-Mir-186_5p (mature (guide))
  7. Gallus gallus Gallus_gallus piRNA piR-gga-65309
  8. Gorilla gorilla gorilla ggo-miR-186 (MIR186)
  9. Gorilla gorilla ggo-miR-186
  10. Macaca mulatta Mml-Mir-186_5p (mature (guide))
  11. Monodelphis domestica mdo-miR-186-5p
  12. Mus musculus Mmu-Mir-186_5p (mature (guide))
  13. Oryctolagus cuniculus ocu-miR-186-5p
  14. Otolemur garnettii (small-eared galago) oga-miR-186
  15. Pan paniscus ppa-miR-186
  16. Pan troglodytes ptr-miR-186
  17. Pteropus alecto pal-miR-186-5p
  18. Rattus norvegicus (Norway rat) Rno-Mir-186_5p (mature (guide))
  19. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-186
  20. Sus scrofa (pig) ssc-miR-186-5p
Publications