Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cavia porcellus (domestic guinea pig) cpo-miR-186-5p URS000015CB3A_10141

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAAGAAUUCUCCUUUUGGGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Bos taurus Bta-Mir-186_5p (mature (guide))
  2. Canis lupus familiaris (dog) Cfa-Mir-186_5p (mature (guide))
  3. Cricetulus griseus (Chinese hamster) cgr-miR-186-5p
  4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-186-5p
  5. Echinops telfairi Ete-Mir-186_5p (mature (guide))
  6. Gallus gallus Gallus_gallus piRNA piR-gga-65309
  7. Gorilla gorilla gorilla ggo-miR-186 (MIR186)
  8. Gorilla gorilla ggo-miR-186
  9. Homo sapiens Hsa-Mir-186_5p (mature (guide))
  10. Macaca mulatta Mml-Mir-186_5p (mature (guide))
  11. Monodelphis domestica mdo-miR-186-5p
  12. Mus musculus Mmu-Mir-186_5p (mature (guide))
  13. Oryctolagus cuniculus ocu-miR-186-5p
  14. Otolemur garnettii (small-eared galago) oga-miR-186
  15. Pan paniscus ppa-miR-186
  16. Pan troglodytes ptr-miR-186
  17. Pteropus alecto pal-miR-186-5p
  18. Rattus norvegicus (Norway rat) Rno-Mir-186_5p (mature (guide))
  19. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-186
  20. Sus scrofa (pig) ssc-miR-186-5p