Automated summary: This pre miRNA sequence is 108 nucleotides long and is found in Drosophila melanogaster. Annotated by 4 databases (RefSeq, ENA, miRBase, FlyBase). Matches 1 Rfam family (mir-193, RF01895). Drosophila melanogaster (fruit fly) microRNA dme-mir-193 precursor sequence is a product of FBgn0262330, mir-193 precursor, 193 precursor RN, mir-193 precurso, mir-193, 193 precursor RNA, mir-193 precursor RNA, dme-mir-193 precursor genes. Found in the fruit fly reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
UGUGUGCCCUUAUUAUGGUUGGGAUUUUUUAGAUCAGCAGUUAUUGCUAUAUAGCCAUAUUUAUAAAUCUUCUACUGGCCUACUAAGUCCCAACAUAAUGAGAGUAAA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.