Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 28 (SNORD28) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 28 (SNORD28) URS000015A7CF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD28: SNORD28 is a small nucleolar RNA (snoRNA) that has been implicated in various diseases, including non-small cell lung cancer (NSCLC) and breast cancer [PMC8677010]. In NSCLC, upregulation of SNORD28 is associated with shorter overall survival, along with the upregulation of SNORD78 and SNORD66 [PMC8677010]. In breast cancer patients, SNHG1, SNORD28, and sno-miR-28 are significantly upregulated in tumor tissues compared to normal tissues [PMC9404758]. sno-miR-28, derived from SNORD28, directly targets the p53-stabilizing gene TAF9B [PMC9149963]. Activation of p53 leads to downregulation of the expression levels of SNORD25, SNORD28, and sno-miR-28 in H1299 cells [PMC4465335]. Although a small RNA derived from SNORD28 is the most abundant small RNA recruited to AGO (Argonaute protein), SNORD29 is the most abundantly expressed snoRNA derived from SNHG1 [PMC4465335]. TaqMan gene expression assays were used to quantify small RNAs including miRNAs and snoRNAs such as miR-21, miR-155, miR-16, miR-24 as well as Custom TaqMan assays for specific snoRNAs including SNORD25 and SNORD28 [PMC4465335, PMC7154078]. In breast cancer patients with disease progression compared to those without progression, differential expression analysis revealed increased expression of two snoRNAs (SNORD28 and SNORD115-5) and one piRNA (piR-33202) [PMC9644097]. In influenza-A-virus-infected cells compared to non-infected cells, the relative expression level of SNORD22 increased while the levels of both SNOD26 and SNDOR29 decreased [PMC9696202].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCAGAUGAUUUGAAUUGAUAAGCUGAUGUUCUGUGAGGUACAAAAGUUAAUAGCAUGUUAGAGUUCUGAUGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications