Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-21a-3p URS000015930E_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-21a: Mmu-mir-21a is a microRNA that plays a crucial role in decidual cells by inhibiting cell apoptosis through targeting Pdcd4 [PMC8099688]. The luciferase reporter assay confirmed the targeting relationship between mmu-mir-21a and Pdcd4 [PMC8099688]. The high conservation of the seed sequence of mmu-mir-21a for the 3′-UTR of Pdcd4 across different mammalian species suggests its importance [PMC8099688]. The expression levels of mmu-mir-21a and Dtprp were higher after induced decidualization in vitro, indicating their involvement in decidualization [PMC8099688]. Inhibition of mmu-mir-21a resulted in an upregulation of Pdcd4 expression and an increase in cell apoptosis, suggesting the regulatory role of mmu-mir-21a on decidual cells [PMC8099688]. Previous studies have also shown an inverse correlation between miR-21 and Pdcd4 expression in various cell types, supporting the hypothesis that mmu-mir-21a targets Pdcd4 in decidual cells [PMC8099688]. In artificially induced decidualized cells, a significant increase in mmu-mir-21a expression was observed along with a decrease in Pdcd4 expression [PMC8099688]. Mmu-mir-21a was found to be highly localized in subluminal stromal cells within the endometrium during decidualization [PMC8099688]. Overall, these findings highlight the importance of mmu-mir-21a as a key regulator for the reconstruction and maintenance of decidual areas during pregnancy establishment and maintenance [PMC8099688]. References: [PMC8099688] Hu SJ, Ren G, Liu JL et al. Mmu-MiR-21a-5p Mediates the Anti-Apoptotic Effect of Estrogen in Decidual Cells by Targeting Pdcd4. Int J Mol Sci. 2021;22(4):2021. doi:10.3390/ijms22042021

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAACAGCAGUCGAUGGGCUGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Artibeus jamaicensis aja-miR-21
  2. Cavia porcellus (domestic guinea pig) cpo-miR-21-3p
  3. Cricetulus griseus cgr-miR-21-3p
  4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-21-3p
  5. Eptesicus fuscus efu-miR-21
  6. Ornithorhynchus anatinus oan-miR-21-3p
  7. Oryctolagus cuniculus ocu-miR-21-3p
  8. Rattus norvegicus (Norway rat) rno-miR-21-3p
Publications