Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C H/ACA small nucleolar RNA (snoRNA) secondary structure diagram

Saccharomyces cerevisiae S288C H/ACA small nucleolar RNA (snoRNA) URS000014B0B1_559292

Automated summary: This snoRNA sequence is 161 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (Rfam, IntAct, ENA, SGD, RefSeq). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snR161, RF01237). Saccharomyces cerevisiae S288C H/ACA small nucleolar RNA (snoRNA) sequence is a product of SNR161 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 2

According to IntAct, Saccharomyces cerevisiae S288C H/ACA small nucleolar RNA (snoRNA) interacts with:

Interaction id Participant Synonyms
EBI-11790217 URS00005F2C2D_559292 EBI-10821373 URS00005F2C2D_559292 rrna 18s yeast
EBI-11790357 URS00005F2C2D_559292 EBI-10821373 URS00005F2C2D_559292 rrna 18s yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAAAUAUACAACACCCAGUAUUUUUGGCUGCCCGUGUCUUUCUCUACCACGGGUAGUCUCUCUAAGCUGGCAGAUAGAUGUUUAUUGAACCGCUUAAGUUCCGUUGUGAAGUUUUCGUCUUUCAGGCUGUAUUUCAUAACACUACUGUAGUUCACACAUAC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 90 other species

    1. Saccharomyces cerevisiae Small nucleolar RNA snR161
    2. Saccharomyces cerevisiae EC1118 SNR161
    3. Saccharomyces cerevisiae FostersB Small nucleolar RNA snR161
    4. Saccharomyces cerevisiae Kyokai no. 7 K7_snR161
    5. Saccharomyces cerevisiae Lalvin QA23 Small nucleolar RNA snR161
    6. Saccharomyces cerevisiae PE-2 SNR161
    7. Saccharomyces cerevisiae R008 snR161
    8. Saccharomyces cerevisiae Vin13 Small nucleolar RNA snR161
    9. Saccharomyces cerevisiae VL3 Small nucleolar RNA snR161
    10. Saccharomyces cerevisiae YJM1078 SNR161
    11. Saccharomyces cerevisiae YJM1083 SNR161
    12. Saccharomyces cerevisiae YJM1129 SNR161
    13. Saccharomyces cerevisiae YJM1133 SNR161
    14. Saccharomyces cerevisiae YJM1190 SNR161
    15. Saccharomyces cerevisiae YJM1199 SNR161
    16. Saccharomyces cerevisiae YJM1202 SNR161
    17. Saccharomyces cerevisiae YJM1208 SNR161
    18. Saccharomyces cerevisiae YJM1242 SNR161
    19. Saccharomyces cerevisiae YJM1244 SNR161
    20. Saccharomyces cerevisiae YJM1250 SNR161
    21. Saccharomyces cerevisiae YJM1252 SNR161
    22. Saccharomyces cerevisiae YJM1273 SNR161
    23. Saccharomyces cerevisiae YJM1304 SNR161
    24. Saccharomyces cerevisiae YJM1307 SNR161
    25. Saccharomyces cerevisiae YJM1311 SNR161
    26. Saccharomyces cerevisiae YJM1326 SNR161
    27. Saccharomyces cerevisiae YJM1332 SNR161
    28. Saccharomyces cerevisiae YJM1336 SNR161
    29. Saccharomyces cerevisiae YJM1338 SNR161
    30. Saccharomyces cerevisiae YJM1341 SNR161
    31. Saccharomyces cerevisiae YJM1355 SNR161
    32. Saccharomyces cerevisiae YJM1356 SNR161
    33. Saccharomyces cerevisiae YJM1381 SNR161
    34. Saccharomyces cerevisiae YJM1385 SNR161
    35. Saccharomyces cerevisiae YJM1387 SNR161
    36. Saccharomyces cerevisiae YJM1388 SNR161
    37. Saccharomyces cerevisiae YJM1389 SNR161
    38. Saccharomyces cerevisiae YJM1400 SNR161
    39. Saccharomyces cerevisiae YJM1402 SNR161
    40. Saccharomyces cerevisiae YJM1415 SNR161
    41. Saccharomyces cerevisiae YJM1417 SNR161
    42. Saccharomyces cerevisiae YJM1418 SNR161
    43. Saccharomyces cerevisiae YJM1419 SNR161
    44. Saccharomyces cerevisiae YJM1433 SNR161
    45. Saccharomyces cerevisiae YJM1434 SNR161
    46. Saccharomyces cerevisiae YJM1444 SNR161
    47. Saccharomyces cerevisiae YJM1447 SNR161
    48. Saccharomyces cerevisiae YJM1450 SNR161
    49. Saccharomyces cerevisiae YJM1460 SNR161
    50. Saccharomyces cerevisiae YJM1477 SNR161
    51. Saccharomyces cerevisiae YJM1478 SNR161
    52. Saccharomyces cerevisiae YJM1479 SNR161
    53. Saccharomyces cerevisiae YJM1526 SNR161
    54. Saccharomyces cerevisiae YJM1527 SNR161
    55. Saccharomyces cerevisiae YJM1549 SNR161
    56. Saccharomyces cerevisiae YJM1573 SNR161
    57. Saccharomyces cerevisiae YJM1574 SNR161
    58. Saccharomyces cerevisiae YJM1592 SNR161
    59. Saccharomyces cerevisiae YJM1615 SNR161
    60. Saccharomyces cerevisiae YJM189 SNR161
    61. Saccharomyces cerevisiae YJM193 SNR161
    62. Saccharomyces cerevisiae YJM244 SNR161
    63. Saccharomyces cerevisiae YJM248 SNR161
    64. Saccharomyces cerevisiae YJM270 SNR161
    65. Saccharomyces cerevisiae YJM271 SNR161
    66. Saccharomyces cerevisiae YJM320 SNR161
    67. Saccharomyces cerevisiae YJM326 SNR161
    68. Saccharomyces cerevisiae YJM428 SNR161
    69. Saccharomyces cerevisiae YJM450 SNR161
    70. Saccharomyces cerevisiae YJM453 SNR161
    71. Saccharomyces cerevisiae YJM456 SNR161
    72. Saccharomyces cerevisiae YJM470 SNR161
    73. Saccharomyces cerevisiae YJM541 SNR161
    74. Saccharomyces cerevisiae YJM554 SNR161
    75. Saccharomyces cerevisiae YJM555 SNR161
    76. Saccharomyces cerevisiae YJM681 SNR161
    77. Saccharomyces cerevisiae YJM682 SNR161
    78. Saccharomyces cerevisiae YJM683 SNR161
    79. Saccharomyces cerevisiae YJM689 SNR161
    80. Saccharomyces cerevisiae YJM693 SNR161
    81. Saccharomyces cerevisiae YJM969 SNR161
    82. Saccharomyces cerevisiae YJM972 SNR161
    83. Saccharomyces cerevisiae YJM975 SNR161
    84. Saccharomyces cerevisiae YJM978 SNR161
    85. Saccharomyces cerevisiae YJM981 SNR161
    86. Saccharomyces cerevisiae YJM984 SNR161
    87. Saccharomyces cerevisiae YJM987 SNR161
    88. Saccharomyces cerevisiae YJM990 SNR161
    89. Saccharomyces cerevisiae YJM993 SNR161
    90. Saccharomyces cerevisiae YJM996 SNR161
    2D structure Publications New