Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-93-5p URS0000149452_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-17: Mmu-mir-17 is an oncogenic miRNA cistron that is overexpressed in mouse tumors [PMC1794537]. Among the highly expressed miRNAs in neuronal cultures, mmu-mir-17 is one of the four that are not differentially regulated [PMC2759968]. Except for mmu-mir-17, none of the other miRNAs are located in a genomic cluster of more than three miRNA genes [PMC2759968]. The expression levels of miR-17 were determined using TaqMan MicroRNA assays [PMC8557618]. In DIO + LFD mice, mmu-mir-17 is one of the 28 upregulated miRNAs [PMC4571067]. In pubertal murine mammary glands, mmu-mir-17 is one of the top 10 enriched miRNAs expressed in all five stages [PMC8944794]. Mmu-mir-17 is part of a group of retroviral insertions that induce overexpression and are oncogenic [PMC2257975]. Mmu-mir-17 belongs to the highly expressed and down-regulated miR-17 family within ovaries, specifically in df/df mice with age [PMC5207734]. The mature sequence of MP-56 has two mismatches with mmu-mir-17, indicating a similarity between them [PMC1315341]. Cluster I on chromosome 14 and cluster II on the X chromosome encompassing mmu-mir-17 are transcribed as single transcriptional units [PMC1421506]. Mmu-mir-17, along with other specific miRNAs, has been associated with an increase in angiogenesis when internalized by endothelial cells (ECs) and released by cardiomyocytes (CMs) under certain conditions such as glucose deprivation or normal culture conditions respectively[ PMC6406975]. [PMC5207734][PMC1315341][PMC1421506][PMC6406975].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAAGUGCUGUUCGUGCAGGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Alligator mississippiensis ami-miR-93-5p
  2. Bos taurus Bta-Mir-17-P4d_5p (mature (guide))
  3. Callithrix jacchus cja-miR-93
  4. Canis lupus familiaris (dog) cfa-miR-93
  5. Capra hircus (goat) chi-miR-93-5p
  6. Cavia porcellus cpo-miR-93-5p
  7. Cervus elaphus cel-miR-93
  8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-17-P4d_5p (mature (guide))
  9. Cricetulus griseus cgr-miR-93-5p
  10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-93-5p
  11. Daubentonia madagascariensis dma-miR-93
  12. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-17-P4d_5p (mature (guide))
  13. Equus caballus eca-miR-93
  14. Gallus gallus Gallus_gallus piRNA piR-gga-56021
  15. Homo sapiens (human) hsa-miR-93-5p
  16. Macaca mulatta Mml-Mir-17-P4d_5p (mature (guide))
  17. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-17-P4d_5p (mature (guide))
  18. Nomascus leucogenys nle-miR-93
  19. Oryctolagus cuniculus (rabbit) ocu-miR-93-5p
  20. Otolemur garnettii oga-miR-93
  21. Papio hamadryas pha-miR-93
  22. Pteropus alecto (black flying fox) pal-miR-93-5p
  23. Rattus norvegicus rno-miR-93-5p
  24. Sarcophilus harrisii Sha-Mir-17-P4d_5p (mature (guide))
  25. Sus scrofa ssc-mir1
  26. Tupaia chinensis tch-miR-93-5p
  27. Tursiops truncatus miR-93
  28. Xenopus laevis (African clawed frog) xla-miR-93-5p
  29. Xenopus tropicalis Xtr-Mir-17-P4d_5p (mature (guide))
Publications