Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-93-5p URS0000149452_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 8 databases (LncBase, ENA, PSICQUIC, RefSeq, TarBase, PirBase, miRBase, MirGeneDB). Mus musculus (house mouse) mmu-miR-93-5p sequence is a product of mmu-miR-93-5p, miR-93-5p, miR-93, mmu-miR-93, Mir93 genes. Found in the house mouse reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610007L03Rik, 0610010B06Rik, 0610010E03Rik, 0610011D08Rik, 0610027D24Rik, 0610033L19Rik, 0710001E20Rik, 0710008M05Rik, 0710008O11Rik, 1110001M19Rik.

Interactions 2

According to PSICQUIC, Mus musculus (house mouse) mmu-miR-93-5p interacts with:

Interaction id Participant Synonyms
URS0000149452_10090-0 E9Q401 E9Q401
URS0000149452_10090-1 E9Q401 E9Q401

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CAAAGUGCUGUUCGUGCAGGUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 29 other species

    1. Alligator mississippiensis ami-miR-93-5p
    2. Bos taurus Bta-Mir-17-P4d_5p (mature (guide))
    3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-93
    4. Canis lupus familiaris cfa-miR-93
    5. Capra hircus (goat) chi-miR-93-5p
    6. Cavia porcellus (domestic guinea pig) cpo-miR-93-5p
    7. Cervus elaphus cel-miR-93
    8. Chrysemys picta bellii Cpi-Mir-17-P4d_5p (mature (guide))
    9. Cricetulus griseus (Chinese hamster) cgr-miR-93-5p
    10. Dasypus novemcinctus dno-miR-93-5p
    11. Daubentonia madagascariensis (aye-aye) dma-miR-93
    12. Echinops telfairi Ete-Mir-17-P4d_5p (mature (guide))
    13. Equus caballus (horse) eca-miR-93
    14. Gallus gallus Gallus_gallus piRNA piR-gga-56021
    15. Homo sapiens hsa-miR-93-5p
    16. Macaca mulatta Mml-Mir-17-P4d_5p (mature (guide))
    17. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-17-P4d_5p (mature (guide))
    18. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-93
    19. Oryctolagus cuniculus (rabbit) ocu-miR-93-5p
    20. Otolemur garnettii oga-miR-93
    21. Papio hamadryas pha-miR-93
    22. Pteropus alecto (black flying fox) pal-miR-93-5p
    23. Rattus norvegicus (Norway rat) rno-miR-93-5p
    24. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-17-P4d_5p (mature (guide))
    25. Sus scrofa ssc-mir1
    26. Tupaia chinensis tch-miR-93-5p
    27. Tursiops truncatus (common bottlenose dolphin) miR-93
    28. Xenopus laevis xla-miR-93-5p
    29. Xenopus tropicalis Xtr-Mir-17-P4d_5p (mature (guide))
    Publications New