Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-2954 URS000014409F_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-2954: Gga-mir-2954 is a microRNA that has been studied for its effects on cell cycle regulatory factors. Over-expression of gga-mir-2954 has been shown to notably downregulate the mRNA expression of CCND1 and CDK6, which are cell cycle regulatory factors [PMC8470131]. Additionally, the relative expression of MyoG and MyHC, which are involved in muscle development, is suppressed when gga-mir-2954 is inhibited [PMC8470131]. These findings suggest that gga-mir-2954 plays a role in regulating cell cycle and muscle development processes [PMC8470131]. Furthermore, it has been observed that the expression of gga-miR-6651-5p increases in chickens infected with Marek's disease virus [PMC7931527]. This indicates that gga-miR-6651-5p may be involved in the immune response to viral infection [PMC7931527]. In summary, gga-mir-2954 is a microRNA that can downregulate the expression of cell cycle regulatory factors and influence muscle development when over-expressed or inhibited [PMC8470131]. Additionally, gga-miR-6651-5p shows increased expression in chickens infected with Marek's disease virus [PMC7931527]. These findings contribute to our understanding of the roles played by these microRNAs in cellular processes and immune responses.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUCCCCAUUCCACUCCUAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications