Automated summary: This miRNA sequence is 22 nucleotides long and is found in Oryctolagus cuniculus. Annotated by 2 databases (miRBase, RefSeq). Oryctolagus cuniculus (rabbit) ocu-miR-22-5p sequence is a product of ocu-miR-22, MIR22, miR-22, ocu-miR-22-5p, miR-22-5p genes. Found in the Oryctolagus cuniculus reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AGUUCUUCAGUGGCAAGCUUUA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.