Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Columba livia (rock pigeon) cli-miR-22-5p URS0000142DC3_8932

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUUCUUCAGUGGCAAGCUUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus bta-miR-22-5p
  2. Cavia porcellus (domestic guinea pig) cpo-miR-22-5p
  3. Cervus elaphus (red deer) cel-miR-22-5p
  4. Chrysemys picta (Painted turtle) cpi-miR-22-5p
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-22-5p
  6. Gallus gallus (chicken) gga-miR-22-5p
  7. Homo sapiens hsa-miR-22-5p
  8. Mus musculus mmu-miR-22-5p
  9. Ornithorhynchus anatinus oan-miR-22-5p
  10. Oryctolagus cuniculus ocu-miR-22-5p
  11. Pteropus alecto (black flying fox) pal-miR-22-5p
  12. Rattus norvegicus (Norway rat) rno-miR-22-5p
  13. Sus scrofa (pig) ssc-miR-22-5p
  14. Xenopus laevis (African clawed frog) Xla-Mir-22-P1b3_5p (mature (co-guide))
  15. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3763164