Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ananas comosus (pineapple) microRNA 167g URS000013A25F_4615

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Ananas comosus. Annotated by 1 database (ENA). Described in 1 paper. Found in the pineapple reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAAGCUGCCAGCAUGAUCUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 55 other species

    1. Aegilops tauschii ata-miR167e-5p
    2. Arabidopsis lyrata aly-miR167a-5p
    3. Arabidopsis thaliana ath-miR167a-5p
    4. Asparagus officinalis aof-miR167a
    5. Brachypodium distachyon bdi-miR167a
    6. Brassica napus (rape) bna-miR167c
    7. Brassica rapa bra-miR167d
    8. Carica papaya cpa-miR167b
    9. Citrus sinensis (sweet orange) csi-miR167e-5p
    10. Corchorus capsularis (jute) sRNA CCACVL1_14458
    11. Corchorus olitorius ahy-miR167-
    12. Cucumis melo (muskmelon) cme-miR167b
    13. Cynara cardunculus var. scolymus cca-miR167c
    14. Digitalis purpurea dpr-miR167b
    15. Glycine max (soybean) gma-miR167a
    16. Gossypium hirsutum (cotton) ghr-miR167a
    17. Helianthus annuus sRNA HannXRQ_Chr10g0281965
    18. Linum usitatissimum (flax) lus-miR167c
    19. Malus domestica mdm-miR167e
    20. Manihot esculenta mes-miR167c
    21. Medicago truncatula mtr-miR167a
    22. Nicotiana tabacum (common tobacco) nta-miR167d
    23. Oryza sativa Japonica Group microRNA osa-miR167b
    24. Oryza sativa (rice) osa-miR167b
    25. Populus tomentosa Pto-miR167d
    26. Populus trichocarpa (black cottonwood) ptc-miR167b
    27. Prunus persica ppe-miR167a
    28. Ricinus communis (castor bean) rco-miR167a
    29. Solanum lycopersicum sly-miR167a
    30. Solanum tuberosum (potato) stu-miR167a-5p
    31. Sorghum bicolor (sorghum) sbi-miR167a
    32. Theobroma cacao (cacao) tcc-miR167b
    33. Triticum aestivum tae-miR167a
    34. Vitis vinifera vvi-miR167d
    35. Zea mays zma-miR167a-5p